 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circZKSCAN1 | |||
| Gene | ZKSCAN1 | Organism | Human |
| Genome Locus | chr7:99621041-99621930:+ | Build | hg19 |
| Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
| DBLink | Link to database | PMID | 28211215 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | HCC tissue and adjacent non tumorous tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGTAATGAGTGCGGGAAGG ReverseAATCAGGTATGAGTTTCGGTTG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Yao, Z, Luo, J, Hu, K, Lin, J, Huang, H, Wang, Q, Zhang, P, Xiong, Z, He, C, Huang, Z, Liu, B, Yang, Y (2017). ZKSCAN1 gene and its related circular RNA (circZKSCAN1) both inhibit hepatocellular carcinoma cell growth, migration, and invasion but through different signaling pathways. Mol Oncol, 11, 4:422-437. | |||